Search results - 199 results

Whole Genome Sequencing Provides an Added Value to the Investigation of Staphylococcal Food Poisoning Outbreaks fmicb-12-750278 October 27, 2021 Time: 15:44 # 1 ORIGINAL RESEARCH published: 02 November 2021 doi: 10.3389/fmicb.2021.750278 Edited by: Caroli ...

untitled GC CONNECTIONS Comprehensive two-dimensional GC THE ESSENTIALS Optimizing sensitivity in GC–FID analysis Modern methods to identify counterfeit medicines and health products Fake News LC TROUBLESHOOTING Reversed-phase LC and water February 2019 V ...

a 2100 Bioanalyzer (Agilent, Santa Clara, USA). Libraries were pre- pared using the PacBio� 2 Kb Template Prep Kit (Pacific Bio- sciences, Menlo Park, USA), according to the manufacturer’s instructions. ...

F, et al. Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2. Prep Biochem Biotechnol. 2014;44:257–65. 17. Fraiture MA, Herman P, Taverniers I, De Loose M, Van ...

primers containing BglII sites. Amplified DNA was then digested with BglII, isolated on a 1% agarose gel, extracted with Prep-A- Gene (Bio-Rad), and inserted in frame with the glutathione S-transferase ...

a standard mini prep procedure. Sequencing of cloned or total PCR products were performed by Eurogen- tec, Belgium. 2320 C. Masungi Luko et al. Eur. J. Immunol. 2000. 30: 2312–2322 Acknowledgements: The ...

d pla samp usly for ing ets an confi be r mple the ce s m. T n tri prep:15 ed fo e six tion. recor t or t recor repa es, t of Ep d Ar ows: 0 ml swaa for m PT ate e ex Scien lven oth real ion. nly e the ...

sequence from plasmid p85A.tub (4) by PCR with the BglII site containing primers. Amplified DNA was digested with BglII, isolated on a 1% agarose gel, and extracted on Prep a Gene (Bio-Rad). Frag- ments were ...

(sense PstS3, CGCGGATCCTCTGTGGTAACGACGACAATGTGACC; anti-sense PstS3, CGCGGATCCCGTCAACCTCAGATCAGG). Amplified DNA was digested with BglII or BamHI, isolated on a 1% agarose gel, and extracted on Prep ...

Consumption of ultra-processed food products and diet quality among children, adolescents and adults in Belgium Vol.:(0123456789)1 3 European Journal of Nutrition (2019) 58:3267–3278 https://doi.org/10.1007/s00394-018-1870-3 ORIGINAL CONTRIBUTION Consumpt ...